Monash Functional Genomics Platform

The cloning of a single guide RNA into a vector of either PLKO, Pxpr003, CROP SEQ guide puro (with or without EGFP/RFPTurbo) or Pxpr_053.

The cloning of a single guide RNA into a vector of either PLKO, Pxpr003, CROP SEQ guide puro (with or without EGFP/RFPTurbo) or Pxpr_053. This is for up to 5x sgRNAs. 

This is a pooled screen for adherent cell lines under low attachment conditions for up to 4 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen on ultra-low attachment plates to provide the added challenge to proliferation and assess colony formation. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

This is a pooled screen for up to 4 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

This is a pooled screen for up to 4 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

Discuss with us about the details of the customised pooled screen and we can tailor the experiment to your needs while providing the best possible price. 

This is a pooled screen for up to 8 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

CROP Seq is a cutting edge technology that allows for single celled RNA seq of a library or around 10 000 cells per experiment. This project is financially assisted with the help of Phenomics Australia covering approximately 50% of the cost of the project. The price provided is the remaining share to be covered by the user. 

This includes the generation of the pooled library DNA for a CROP Seq (Single Celled RNA Seq of a pooled screen) pooled screen, the generation of lentivirus for the pooled screen and the pooled screen itself. 

Production of ≥ 100 ug of pDNA of a pooled library. This includes the library preparation and confirmation of the guide RNAs via next gen pooled sequencing for libraries for 12 000 to 92 000 guides.

Production of ≥ 100 ug of pDNA of a pooled library. This includes the library preparation and confirmation of the guide RNAs via next gen pooled sequencing for libraries up to 12 000 guides. 

We provide library preparation for next generation sequencing. This service allows you to provide genomic DNA from the screen, we then prepare it and provide you the the bioformatic results and intepretation of the data. The number of replicates is dependent upon the size of the library. Up to 15 libraries/replicates for those under 10 000 guides & up to 6 libraries/replicates for libraries of 70 000 guides. 

Mycoplasma testing offered by qPCR using primers:
5' CTTCWTCGACTTYCAGACCCAAGGCA 
5' ACACCATGGGAGCTGGTAAT
Amplification curves below 33 CT are classed as positive. Values between 33 and 37 CT or samples without smooth amplification curves are ambigious. Samples with CT values above 37 and/or disjunct amplification curves are classed as negative. 

Runs are completed once per fortnight and results are returned via a comment on your ilab request. 

To provide samples plate the cell line in a dish - 12 well or 6 well format is recommended - and allow the cells to overgrow. The goal is to allow the cells to lyse from over confluence and release mycoplasma into the supernatant. Collect the supernatant and spin out the debris at 300g for 5 mins and move the supernatant to a new tube. Label these tubes with the identifying names in the sheet below. Place these samples in a box labelled with the user's name and containing the printed sheet of the order. 

Place this box in the Monash Functional Genomics Platform collection point freezer on level 3 building 77. 

IMPORTANT: Do not provide lentivirus. Testing lentivirus directly is prone to false negatives and not compliant with PC2 guidelines. To test lentivirus. Infect a cell line with the virus and grow the cells out for a minimum of 1 week. Passage the cells twice to step down from lentivirus infection to standard PC2 compliance. Then plate in a 6 or 12 well format as above. 

All cell lines that have been exposed to lentivirus must be stepped down to standard PC2. This requires the cells to have been passaged 2 times and had 4 media changes prior to providing a sample to the Monash Functional Genomics Platform. 

Production of 9ml of a replication deficient lentivirus in DMEM 30% FBS at standard particle concentration from provided DNA for sgRNAs or other provided vectors. 

Production of 9ml of a replication deficient lentivirus designed to induce double stranded breaks in safe harbour genes. This acts as effective negative controls in experiments when following up hits from pooled screens. 

AAVS1 and ROSA26 guides are available in Pxpr003 or CROPseq-puro mCherry/GFP vectors. A choice from 5 different AAVS1 guides and 2 different mROSA26 guides are available.

Production of 9ml of a replication deficient lentivirus in DMEM 30% FBS at standard particle concentration from provided DNA for up to 5 sgRNAs or other provided vectors. 

This includes 5ml of the desired lentivirus for CRISPRc/i/a vectors with blasticidin resistance. 

This includes 5ml of Pxpr011 lentivirus to validate the effectiveness of Cas9 infection. 

This is a pooled screen for up to 4 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

This is a pooled screen for up to 8 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

This is a pooled screen for adherent cell lines under low attachment conditions for up to 4 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen on ultra-low attachment plates to provide the added challenge to proliferation and assess colony formation. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

This is a pooled screen for up to 4 replicates with either a provided library DNA or the standard genome wide library (human Brunello OR mouse Brie). Cas9-P2A-Blast lentivirus is provided and Prpx011-GFP-Puro lentivirus is included to validate the activate of the Cas9 infection. This includes a titration and mycoplasma test of the provided cell line followed by performing the pooled screen. The screen is prepared in house for sequencing. Sequencing results are analysed and interpreted by our bioinformatician to provide feedback and potential future directions of the project. 

Discuss with us about the details of the customised pooled screen and we can tailor the experiment to your needs while providing the best possible price. 

Production of ≥ 100 ug of pDNA of a pooled library. This includes the library preparation and confirmation of the guide RNAs via next gen pooled sequencing for libraries up to 12 000 guides. 

Production of ≥ 100 ug of pDNA of a pooled library. This includes the library preparation and confirmation of the guide RNAs via next gen pooled sequencing for libraries for 12 000 to 92 000 guides.

We provide library preparation for next generation sequencing. This service allows you to provide genomic DNA from the screen, we then prepare it and provide you the the bioformatic results and intepretation of the data. The number of replicates is dependent upon the size of the library. Up to 15 libraries/replicates for those under 10 000 guides & up to 6 libraries/replicates for libraries of 70 000 guides. 

CROP Seq is a cutting edge technology that allows for single celled RNA seq of a library or around 10 000 cells per experiment. This project is financially assisted with the help of Phenomics Australia covering approximately 50% of the cost of the project. The price provided is the remaining share to be covered by the user. 

This includes the generation of the pooled library DNA for a CROP Seq (Single Celled RNA Seq of a pooled screen) pooled screen, the generation of lentivirus for the pooled screen and the pooled screen itself. 

The cloning of a single guide RNA into a vector of either PLKO, Pxpr003, CROP SEQ guide puro (with or without EGFP/RFPTurbo) or Pxpr_053.

The cloning of a single guide RNA into a vector of either PLKO, Pxpr003, CROP SEQ guide puro (with or without EGFP/RFPTurbo) or Pxpr_053. This is for up to 5x sgRNAs. 

Production of 9ml of a replication deficient lentivirus in DMEM 30% FBS at standard particle concentration from provided DNA for sgRNAs or other provided vectors. 

Production of 9ml of a replication deficient lentivirus in DMEM 30% FBS at standard particle concentration from provided DNA for up to 5 sgRNAs or other provided vectors. 

This includes 5ml of the desired lentivirus for CRISPRc/i/a vectors with blasticidin resistance. 

This includes 5ml of Pxpr011 lentivirus to validate the effectiveness of Cas9 infection. 

Production of 9ml of a replication deficient lentivirus designed to induce double stranded breaks in safe harbour genes. This acts as effective negative controls in experiments when following up hits from pooled screens. 

AAVS1 and ROSA26 guides are available in Pxpr003 or CROPseq-puro mCherry/GFP vectors. A choice from 5 different AAVS1 guides and 2 different mROSA26 guides are available.

Mycoplasma testing offered by qPCR using primers:
5' CTTCWTCGACTTYCAGACCCAAGGCA 
5' ACACCATGGGAGCTGGTAAT
Amplification curves below 33 CT are classed as positive. Values between 33 and 37 CT or samples without smooth amplification curves are ambigious. Samples with CT values above 37 and/or disjunct amplification curves are classed as negative. 

Runs are completed once per fortnight and results are returned via a comment on your ilab request. 

To provide samples plate the cell line in a dish - 12 well or 6 well format is recommended - and allow the cells to overgrow. The goal is to allow the cells to lyse from over confluence and release mycoplasma into the supernatant. Collect the supernatant and spin out the debris at 300g for 5 mins and move the supernatant to a new tube. Label these tubes with the identifying names in the sheet below. Place these samples in a box labelled with the user's name and containing the printed sheet of the order. 

Place this box in the Monash Functional Genomics Platform collection point freezer on level 3 building 77. 

IMPORTANT: Do not provide lentivirus. Testing lentivirus directly is prone to false negatives and not compliant with PC2 guidelines. To test lentivirus. Infect a cell line with the virus and grow the cells out for a minimum of 1 week. Passage the cells twice to step down from lentivirus infection to standard PC2 compliance. Then plate in a 6 or 12 well format as above. 

All cell lines that have been exposed to lentivirus must be stepped down to standard PC2. This requires the cells to have been passaged 2 times and had 4 media changes prior to providing a sample to the Monash Functional Genomics Platform.